ceeceehubbard97 ceeceehubbard97

03-04-2017
Mathematics

contestada

How many roots do the following equations have? -12x2 - 25x + 5 + x3 = 0

Respuesta :

03-04-2017

X= -1.970, 0.183, 13.786
Do you need an explanation?

Answer Link

Otras preguntas

A physics student sits in a chair. The chair pushes up on the student's body. Identify the other force of the interaction force pair.

Why do kids need education? Why is it important? DO NOT USE G*OGLE

Larry makes sandwiches for lunch every day. He can make 6 sandwiches with every 3 tomatoes he buys. If he bought 9 tomatoes, how many sandwiches could he make?A

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Please help me please help me this is my final!!!!!!!!! True or false

A hospital has to be patrolled by security guards 24 hours a day. Seven security guards are ordered to split each day’s guard duty equally. How long will each s

answer for points(No need to do a explaination on how u got it)The variable of B stands for the (area of the base)(height)(length)(width)In this prism, B equals

0.5(12n – 8) = 26 show your work

You have engineered a protein that contains a nuclear localization signal, a nuclear export signal, a C-terminal peroxisomal targeting signal, and an import sig

on: *2 2x - 8. 3x-2/4=2x-8