sophiacarson sophiacarson
  • 01-02-2017
  • Social Studies
contestada

how fast weathering occurs depends on the --------- on an area

a) oxygen c) water

b) climate d) vegetation

Respuesta :

AwesomeDude357
AwesomeDude357 AwesomeDude357
  • 01-02-2017
climate b is the correct answer


Answer Link
Аноним Аноним
  • 01-02-2017
--climate-- on an area because if it's too hot it won't grow, and if it is too cold it might freeze and not grow.

Hoped I helped!
Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Why did the french revolution happen and who's fault was it
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Explain who or what "Año Viejo" is and its significance.
Help pl0x, Algebra 1
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5