tyzavierchambers79 tyzavierchambers79

01-09-2021
Mathematics

contestada

Which answer choice shows the number 9.54×10−3 in standard form?

Respuesta :

raemckae06 raemckae06

01-09-2021

Answer:

95.4

.................

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,

An airline’s weekly flight data showed a 98% probability of being on time. If this airline has 15,000 flights in a year, how many flights would you predict to a

Which component of a phospholipid is found in the interior of a lipid bilayer?

Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -

What are at least three differences between apes and humans in the cranium and teeth?

what is 3/5 of 21? plz answer the question

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

what are the zeros of the polynomial x2+4x-12

Remembering how to ride a bicycle, even though you have not ridden one for years, is an example of _____ memory.