alexphel
alexphel alexphel
  • 03-05-2021
  • Mathematics
contestada

What is the mean for the data shown in the dot plot?



4
5
6
10

What is the mean for the data shown in the dot plot 4 5 6 10 class=

Respuesta :

cangel13 cangel13
  • 03-05-2021

Answer:

6

Step-by-step explanation:

add 4 + 5(4)+6(3)+7(2)+10 once you add those divide it by 11 because that is how many data points there are. so the mean (average) is 6

Answer Link
sheesh103
sheesh103 sheesh103
  • 03-05-2021
Yup it’s 6 I hate this topic in math tbh
Answer Link

Otras preguntas

Plz help me with this question ASAP
What would happen to the demand curve for a particular brand of shampoo if a famous movie actress with beautiful hair announces that it is the best shampoo she
help me solve for k please anyone
The point P(-5, -10) is rotated 90° counterclockwise about the origin. What are the coordinates of P'? *
£450 is invested at 3% simple interest. How much interest will be earned in 4 years?
100 points and a Brainliest just answer this question what is dabi real name off of my hero academia
Find the measure of each angle.
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
3 - 2n=1 - 2n Lo nesito
anyone know how to write an email to teacher because im sick ( we have test today but im absent)