castanedabeyonce castanedabeyonce

02-03-2021
English

contestada

I need help with number 11 please help

I need help with number 11 please help class=

Respuesta :

isaiahouy12 isaiahouy12

02-03-2021

The answer is c hope it helped

Answer Link

munequitarachel munequitarachel

02-03-2021

I think it’s schedule

Answer Link

Otras preguntas

Ill give brainliest to the person who gets it right!!!!!!!

HELP ME ASAP !!!!! WILL MARK BRAINLIEST!!! During a road trip, Daysia keeps track of the time she spends driving, t, and the distance she drives, d. Which best

d) How & why did Renaissance art change?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Guys pls help me!!!!!! pls be correct not wrong and don’t make me loose my points

Brainliest stars 21) In which container is the probability of randomly selecting a red ball on one draw 3/7?

Find the volume: 5 cm cm 1ac 6.5cmPls help-?

What is produced through cellular respiration? A. Carbon dioxide B. Glucose C. Oxygen D. Protein

Which process is used to change the constitution? A. Initiative B. Eminent C. Referendum S. Amendment

I will give brainliestWhat is agglomeration economics