Seudónimo Seudónimo
  • 03-11-2016
  • Biology
contestada

Why are certain toads in the amphibian family call spadefoot toad?

Respuesta :

sully6 sully6
  • 04-11-2016
because their foots is shaped like a spade
Answer Link

Otras preguntas

Companies raise funds to expand their business by
four yardequal Blank feet
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
why did Mr Collins come to the Bennet family looking for a wife?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
How do you write fifty-seven thousand,eighteen. In standard form