cls11024
cls11024 cls11024
  • 04-01-2021
  • Mathematics
contestada

Sam is climbing 20 m every 20 minutes. How many meters will he climb in 1 hour?

Respuesta :

anampuh
anampuh anampuh
  • 04-01-2021

sam will climb 60m

Step-by-step explanation:

Answer Link

Otras preguntas

is a centimeter one tenth or one hundredth or a meter
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
How did the mountains in Greece contribute to the rise of city-states?