nicole497 nicole497
  • 03-12-2020
  • History
contestada

What major development led to the Greeks’ success in literature and drama?

Respuesta :

aubrey7283
aubrey7283 aubrey7283
  • 03-12-2020
The Greeks made important contributions to philosophy, mathematics, astronomy, and medicine. Literature and theatre was an important aspect of Greek culture and influenced modern drama. The Greeks were known for their sophisticated sculpture and architecture.
Answer Link

Otras preguntas

I do not understand the question need some help solving
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What step of the scientific method might be the most difficult when studying creature's that lived millions years ago
QUESTION 15 I need help
pls helppp! i don’t understand:|
El turpial es un ___que se distingue por su canto.
Type the correct answer in the box. Spell all words correctly. Fill in the box with one of the following terms: anemia, asthma, arthritis, arteriosclerosis. Sue
Write a slope-intercept equation for a line passing through the point (4, -3) that is parallel to the line 4x + 5y = 7. Then write a second equation for a line
I ain’t been there in two years. a. years c. been b. ain’t d. years Please select the best answer from the choices provided A B C D
what is the most effective way to avoid an unwanted pregnancy?